Calculating Methylation Frequency with BSMAP Reads

My preferred program for aligning bisulfite-sequencing reads to a reference is BSMAP. BSMAP is based on SOAP and aligns reads fairly quickly considering the variability that bisulfite treatment introduces. While there are other fast BS-Seq aligners (GSNAP, Bismark, BS Seeker) I prefer BSMAP because it comes with the script methratio.py to post-process the aligned reads for quick interpretation. The script parses all aligned reads and produces a tabulated output similar to VCF (Variant Call Format) which not only includes the methylation frequency, but also base representation from both strands. Below is an example of the output from methratio.py.

chr pos strand context ratio eff_CT C CT rev_G rev_GA CI_lower CI_upper
Chr1 34 - CTGAA 0.200 5.00 1 5 0 0 0.036 0.624
Chr1 80 - ATGAA 0.000 6.00 0 6 2 2 0.000 0.390
Chr1 93 + TACCT 0.400 5.00 2 5 7 7 0.118 0.769
Chr1 94 + ACCTA 0.000 5.00 0 5 7 7 -0.000 0.434
Chr1 100 + TTCCC 0.000 5.00 0 5 7 7 -0.000 0.434
Chr1 101 + TCCCT 0.000 5.00 0 5 7 7 -0.000 0.434
Chr1 102 + CCCTA 0.000 6.00 0 6 7 7 0.000 0.390
Chr1 107 + AACCC 0.143 7.00 1 7 7 7 0.026 0.513
Chr1 108 + ACCCG 0.875 8.00 7 8 7 7 0.529 0.978

My current project on allele specific methylation requires the raw read information instead of just the methylation frequency, so I decided to figure out what information is used to arrive at these methylation frequencies. To start off, I run BSMAP with the following parameters:

bsmap -a read1.fq -b read2.fq -d reference.fa -o out.bam -w 2 -q 20 -z 33 -p 1 -r 0
Flag Value Description
-w 2 Only outputs the two equally best hits (multiply mapping)
-q 20 Trims the tails of reads when quality is below a threshold of 20
-z 33 Quality score format
-p 1 Number of processors to use
-r 0 Only report unique hits

I use the redundant combination of -w and -r because I’m not sure if the unique hits are parsed out after processing, so I make sure read alignment stops when two equally best hits are found, which are then never reported because I only output unique hits. I then post-process the alignment files with methratio.py as follows:

methratio.py -o out_methratio.txt -d reference.fa -u -p -z -r -m 5 in.bam
Flag Value Description
-u   Only uses unique hits (redundant)
-p   Only uses reads mapped in a proper pair
-z   Report locations with zero-methylation (only T’s reported)
-r   Remove duplicate reads
-m 5 Require read-depth of 5

I began my investigation at base 108 in Chromosome 1 of the TAIR10 reference since it only had 8 reads contributing to the methylation frequency, making it a simple place to start.

Chr1    108     +       ACCCG   0.875   8.00    7       8       7       7       0.529   0.978

This record shows that of the reads 8 reads mapped to the positive strand at this location, 7 are reported as Cs (methylated) and 1 is a T (unmethylated). This means the final methylation frequency is 1/8 (0.875). I first checked the corresponding bam file (explanation) to see what reads were mapped to that location.

$ samtools view in.bam Chr1:108-108 | wc -l
55

Since 55 reads was more than the final 8, I decided to filter my reads using the same rules I specified for methratio.py. I first used samtools rmdup to remove duplicate reads. Then, I filtered out reads that weren’t mapped in a pair using samtools view. This left me with 13 reads.

$ samtools view -b in.bam Chr1:108-108 > tmp.bam
$ samtools rmdup -h
$ samtools rmdup -S tmp.bam tmp_rmdup.bam
$ samtools view -f 2 tmp_rmdup.bam | wc -l
13

This method filtered out many of the extra reads, but I still had 5 more to remove from the set. Looking at the SAM records for all 13 reads made me realize that some were coming from the opposite strand of the CHG motif I was targeting, so they couldn’t contribute any information about the methylation of the cytosine at 108. BSMAP keeps track of the strand information with the ZS:Z field.

ZS:Z Field Description
++ forward strand of Watson of reference (BSW)
+- reverse strand of Watson of reference (BSWC)
-+ forward strand of Crick of reference (BSC)
– reverse strand of Crick of reference (BSCC)

From the 13 reads remaining, I filtered out any that came from the Crick of the reference (- strand) and was left with 8 reads. To make sure these were the reads I was looking for, I made a quick visualization of the results in samtools tview.

1           1         1
0           2         3
8           0         0
==============================
CCGAAATCGGTTTTTCTGGTTGAAAATTAT
ccgaaatcggtttttctggttgaaaattat
ccgaaatcggtttttctggttgaaaattat
CCGAAATCGGTTTTTCTGGTTGAAAATTAT
TCGAAATCGGTTTTTCTGGTTGAAAATTAT
CCGAAATCGGTTTCTCTGGTTGAAAATCAT
CCGAAACCGGTTTTTCTGGTTGAAAATCAT
CCGAAATTGGTTTCTCTGGTTGAAAATCAT

This shows that I have now recovered all 8 reads used by methratio.py to calculate the methylation frequency at base 108 in chromosome 1. This method also worked for

Chr1    34      -       CTGAA   0.200   5.00    1       5       0       0       0.036   0.624

on the negative strand, but I only accepted reads from the Crick of the reference. Based on this result, it doesn’t look like BSMAP requires reads from the opposite strand even though it looks at he G to A ratio. I may improve upon this script in the future and add a flag to require at least N G/A reads from the opposite strand.

10 Jun 2014